::Definition
The Orphan Designation is a legal procedure that allows for the designation of a medicinal substance with therapeutic potential for a rare disease, before its first administration in humans or during its clinical development.
The exact therapeutic indication is then defined at the time of marketing authorisation.
This procedure has been established in Europe by the Regulation (EC) No 141/2000
(http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2000:018:0001:0005:EN:PDF)
Similar procedures exist in the US, Australia, Japan and Singapore.
::Help
Choose a letter from the alphabetical list and click on it in order to obtain substances with at least an orphan designation. The concerned geographical area(s) is(are) indicated.
Then click on the substance name to access to the “Substance” sheet or click on the geographical area in order to obtain detailed information on the designation(s) in that particular area.
The list of Orphan Drugs in the Orphanet database includes all the substances which have been granted an orphan designation for disease(s) considered as rare in Europe, whether they were further developed to become drugs with marketing authorisation (MA) or not.
The data is extracted from official sources.
You can also access European or American designation data, respectively, through these two links :
http://ec.europa.eu/enterprise/sectors/pharmaceuticals/documents/community-register/html/alforphreg.htm(Europe)
http://www.fda.gov/ForIndustry/DevelopingProductsforRareDiseasesConditions/HowtoapplyforOrphanProductDesignation/default.htm (USA)
Orphanet acknowledges the contribution of the European Medicines Agency (EMA) to the creation of the database on orphan medicinal products in Europe. This project was initiated by the Committee for Orphan Medicinal Products (COMP) at the EMA.
Several members of the COMP have individually contributed to the development of the database, which was welcomed by the COMP as a significant tool for all stakeholders.
The database has been developed entirely and autonomously by Orphanet, using public and private funding and publicly available data; as such, neither the EMA nor the COMP are responsible for the content and management of the database.
The Orphanet database of orphan drugs was developed with co-funding from the following institutions and companies:

Orphan Designations by geographical area
- Aav2-Hrpe65v2
- Abagovomab
- Acadesine
- Acetylsalicylic acid
- Adalimumab
- Adeno-associated viral (AAV) vector expressing human retinoschisin-1 gene
- Adeno-associated viral vector containing a modified U7-snRNA gene
- Adeno-associated viral vector containing DNA encoding an RNAi targeting rhodopsin / adeno-associated viral vector containing a rhodopsin gene
- Adeno-associated viral vector containing modified U1 snRNA
- Adeno-associated viral vector containing porphobilinogen deaminase gene
- Adeno-associated viral vector containing the human alpha-N-acetylglucosaminidase gene
- Adeno-associated viral vector containing the human alpha-sarcoglycan gene
- Adeno-associated viral vector containing the human ARSB gene
- Adeno associated viral vector containing the human calpain 3 gene
- Adeno-associated viral vector containing the human factor IX gene
- Adeno-associated viral vector containing the human gamma-sarcoglycan gene
- Adeno-associated viral vector containing the human NADH dehydrogenase 4 gene
- Adeno-associated viral vector encoding an inducible short hairpin RNA targeting claudin-5 (prior to administration of 17-dimethylaminoethylamino-17-demethocygeldanamycin)
- Adeno-associated viral vector expressing lipoprotein lipase
- Adeno-associated viral vector of serotype 5 containing the human alanine-glyoxylate aminotransferase gene
- Adeno-associated viral vector serotype 5 containing the human ABCA4 gene
- Adeno-associated viral vector serotype 8 containing the human AIPL1 gene
- Adeno-associated viral vector serotype 9 containing the human N-acetylglucosaminidase alpha gene
- Adeno-associated viral vector serotype 9 containing the human sulfamidase gene
- Adenoviral vector containing human p53 gene
- Adenovirus-associated vector containing human Fas-c gene
- Adenovirus-associated viral vector serotype 10 carrying the human N-sulfoglucosamine sulfohydrolase and sulfatase modifying factor 1 cDNAs
- Adenovirus-associated viral vector serotype 2 containing the human RPE65 gene
- Adenovirus associated viral vector serotype 4 containing the human RPE65 gene
- Adenovirus-mediated Herpes Simplex Virus-thymidine kinase (HKSV-tk) gene
- Adrenomedullin
- Afamelanotide
- Agalsidase alfa
- Agalsidase beta
- Albendazole
- Aldesleukin
- Alemtuzumab
- Alginate oligosaccharide (G-block) fragment
- Alglucerase
- Alicaforsen
- Alisertib
- Alitretinoin
- Allogeneic aortic endothelial cells cultured in a porcine gelatin matrix
- Allogeneic bone marrow stem cells treated ex vivo with 16,16-dimethyl prostaglandin E2
- Allogeneic ex vivo expanded umbilical cord blood cells
- Allogeneic human dendritic cells derived from a CD34+ progenitor cell line
- Allogeneic human dermal fibroblasts
- Allogeneic motor neuron progenitor cells derived from human embryonic stem cells
- Allogeneic retinal epithelial cells transfected with plasmid vector expressing ciliary neurotrophic growth
- Allogeneic T cells encoding an exogenous TK gene
- Allogeneic umbilical cord blood cells treated ex vivo with 16,16-dimethyl prostaglandin E2
- Allopurinol sodium
- Alpha-1 antitrypsin (inhalation use)
- Alpha-1 proteinase inhibitor
- Alpha-1 proteinase inhibitor (inhalation use)
- Alpha-tocotrienol quinone
- Alvocidib
- Ambrisentan
- Amikacin sulfate (liposomal)
- Aminosalicylic acid
- A mixture of anti-CD3 mAb (SPV-T3a)-ricin A chain fusion protein and anti-CD7 mAb (WT1)-ricin A chain fusion protein
- Ammonium tetrathiomolybdate
- Amphotericin B
- Amphotericin B (for inhalation use)
- Amrubicin hydrochloride
- Anagrelide hydrochloride
- Anthrax Immune Globulin
- Anti-EphA2 monoclonal antibody conjugated to maleimidocaproyl monomethylauristatin phenylalanine
- Anti-epithelial cell adhesion molecule / anti-CD3 monoclonal antibody
- Antihemophilic factor / Von Willebrand factor complex (human)
- Anti RHO (D) immune globulin intravenous (human)
- Antisense NF-kappaB p65 Oligonucleotide
- Antisense oligonucleotide 5'-d[P-Thio} (CCCTG CTCCC CCCTG GCTCC)-3'
- Antisense oligonucleotide targeted to the SMN2 gene
- Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
- Antithrombin alfa
- Antithrombin III (human)
- Apomorphine HCL
- Apomorphine hydrochloride
- Apomorphine hydrochloride (inhalation use)
- Arimoclomol
- Arsenic trioxide
- Artemether/lumefantrine
- Artesunate
- Ascorbic acid
- Asp-Arg-Val-Try-Ile-His-Pro
- Ataluren
- Atovaquone
- Autologous bone marrow-derived mononuclear cell fraction
- Autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase AcDNA
- Autologous CD34+ cells transfected with lentiviral vector containing the Wiskott-Aldrich syndrome protein gene
- Autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene
- Autologous CD34+ haematopoietic stem cells transduced with lentiviral vector encoding the human betaA-T87Q-globin gene
- Autologous cultured endothelial cells on a donor human corneal disk
- Autologous dendritic cells pulsed with autologous cell lysate
- Autologous dendritic cells pulsed with recombinant human-fusion protein (mucin 1 - glutathione S transferase) coupled to oxidised polymannose
- Autologous haematopoietic cells genetically modified with a lentiviral vector containing the human gp91(phox) gene
- Autologous haematopoietic stem cells transduced with lentiviral vector encoding the human beta-globin gene
- Autologous haematopoietic stem cells transduced with lentiviral vector Lenti-D encoding the human ABCD1 cDNA
- Autologous Olfactory Neural Progenitors
- Autologous renal cell tumor vaccine
- Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex
- Autologous tumour-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin
- Autologous urothelial and smooth muscle cells
- Avian polyclonal IgY antibody against Pseudomonas aeruginosa
- Aviptadil
- Axitinib
- Azacitidine
- Aztreonam lysinate (inhalation use)










