Orphan Designations by geographical area
- Aav2-Hrpe65v2
- Abagovomab
- Acadesine
- Acetylsalicylic acid
- Adalimumab
- Adeno-associated viral (AAV) vector expressing human retinoschisin-1 gene
- Adeno-associated viral vector containing a modified U7-snRNA gene
- Adeno-associated viral vector containing DNA encoding an RNAi targeting rhodopsin / adeno-associated viral vector containing a rhodopsin gene
- Adeno-associated viral vector containing modified U1 snRNA
- Adeno-associated viral vector containing porphobilinogen deaminase gene
- Adeno-associated viral vector containing the human alpha-N-acetylglucosaminidase gene
- Adeno-associated viral vector containing the human alpha-sarcoglycan gene
- Adeno-associated viral vector containing the human ARSB gene
- Adeno associated viral vector containing the human calpain 3 gene
- Adeno-associated viral vector containing the human factor IX gene
- Adeno-associated viral vector containing the human gamma-sarcoglycan gene
- Adeno-associated viral vector containing the human NADH dehydrogenase 4 gene
- Adeno-associated viral vector encoding an inducible short hairpin RNA targeting claudin-5 (prior to administration of 17-dimethylaminoethylamino-17-demethocygeldanamycin)
- Adeno-associated viral vector expressing lipoprotein lipase
- Adeno-associated viral vector of serotype 5 containing the human alanine-glyoxylate aminotransferase gene
- Adeno-associated viral vector serotype 5 containing the human ABCA4 gene
- Adeno-associated viral vector serotype 8 containing the human AIPL1 gene
- Adeno-associated viral vector serotype 9 containing the human N-acetylglucosaminidase alpha gene
- Adeno-associated viral vector serotype 9 containing the human sulfamidase gene
- Adenoviral vector containing human p53 gene
- Adenovirus-associated vector containing human Fas-c gene
- Adenovirus-associated viral vector serotype 10 carrying the human N-sulfoglucosamine sulfohydrolase and sulfatase modifying factor 1 cDNAs
- Adenovirus-associated viral vector serotype 2 containing the human RPE65 gene
- Adenovirus associated viral vector serotype 4 containing the human RPE65 gene
- Adenovirus-mediated Herpes Simplex Virus-thymidine kinase (HKSV-tk) gene
- Adrenomedullin
- Afamelanotide
- Agalsidase alfa
- Agalsidase beta
- Albendazole
- Aldesleukin
- Alemtuzumab
- Alginate oligosaccharide (G-block) fragment
- Alglucerase
- Alicaforsen
- Alisertib
- Alitretinoin
- Allogeneic aortic endothelial cells cultured in a porcine gelatin matrix
- Allogeneic bone marrow stem cells treated ex vivo with 16,16-dimethyl prostaglandin E2
- Allogeneic ex vivo expanded umbilical cord blood cells
- Allogeneic human dendritic cells derived from a CD34+ progenitor cell line
- Allogeneic human dermal fibroblasts
- Allogeneic motor neuron progenitor cells derived from human embryonic stem cells
- Allogeneic retinal epithelial cells transfected with plasmid vector expressing ciliary neurotrophic growth
- Allogeneic T cells encoding an exogenous TK gene
- Allogeneic umbilical cord blood cells treated ex vivo with 16,16-dimethyl prostaglandin E2
- Allopurinol sodium
- Alpha-1 antitrypsin (inhalation use)
- Alpha-1 proteinase inhibitor
- Alpha-1 proteinase inhibitor (inhalation use)
- Alpha-tocotrienol quinone
- Alvocidib
- Ambrisentan
- Amikacin sulfate (liposomal)
- Aminosalicylic acid
- A mixture of anti-CD3 mAb (SPV-T3a)-ricin A chain fusion protein and anti-CD7 mAb (WT1)-ricin A chain fusion protein
- Ammonium tetrathiomolybdate
- Amphotericin B
- Amphotericin B (for inhalation use)
- Amrubicin hydrochloride
- Anagrelide hydrochloride
- Anthrax Immune Globulin
- Anti-EphA2 monoclonal antibody conjugated to maleimidocaproyl monomethylauristatin phenylalanine
- Anti-epithelial cell adhesion molecule / anti-CD3 monoclonal antibody
- Antihemophilic factor / Von Willebrand factor complex (human)
- Anti RHO (D) immune globulin intravenous (human)
- Antisense NF-kappaB p65 Oligonucleotide
- Antisense oligonucleotide 5'-d[P-Thio} (CCCTG CTCCC CCCTG GCTCC)-3'
- Antisense oligonucleotide targeted to the SMN2 gene
- Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
- Antithrombin alfa
- Antithrombin III (human)
- Apomorphine HCL
- Apomorphine hydrochloride
- Apomorphine hydrochloride (inhalation use)
- Arimoclomol
- Arsenic trioxide
- Artemether/lumefantrine
- Artesunate
- Ascorbic acid
- Asp-Arg-Val-Try-Ile-His-Pro
- Ataluren
- Atovaquone
- Autologous bone marrow-derived mononuclear cell fraction
- Autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase AcDNA
- Autologous CD34+ cells transfected with lentiviral vector containing the Wiskott-Aldrich syndrome protein gene
- Autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene
- Autologous CD34+ haematopoietic stem cells transduced with lentiviral vector encoding the human betaA-T87Q-globin gene
- Autologous cultured endothelial cells on a donor human corneal disk
- Autologous dendritic cells pulsed with autologous cell lysate
- Autologous dendritic cells pulsed with recombinant human-fusion protein (mucin 1 - glutathione S transferase) coupled to oxidised polymannose
- Autologous haematopoietic cells genetically modified with a lentiviral vector containing the human gp91(phox) gene
- Autologous haematopoietic stem cells transduced with lentiviral vector encoding the human beta-globin gene
- Autologous haematopoietic stem cells transduced with lentiviral vector Lenti-D encoding the human ABCD1 cDNA
- Autologous Olfactory Neural Progenitors
- Autologous renal cell tumor vaccine
- Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex
- Autologous tumour-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin
- Autologous urothelial and smooth muscle cells
- Avian polyclonal IgY antibody against Pseudomonas aeruginosa
- Aviptadil
- Axitinib
- Azacitidine
- Aztreonam lysinate (inhalation use)










