::Definition
Die Orphan-Designation wird in einem rechtsgültigen Verfahren erteilt. Es erlaubt die Kennzeichnung eines medizinischen Wirkstoffs, dem ein therapeutisches Potential für die Behandlung einer seltenen Krankheit zugesprochen wird, bevor dieser Wirkstoff erstmalig zur Behandlung von Menschen genutzt wird oder während er sich in der klinischen Entwicklungsphase befindet. Die exakte therapeutische Indikation wird zum Zeitpunkt der Marktzulassung definiert.
Dieses Verfahren wurde in Europa durch die Regulation (EC) No 141/2000 realisiert.
(http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2000:018:0001:0005:DE:PDF)
Ähnliche Verfahren existieren in den Vereinigten Staaten, Australien, Japan und Singapur.
::Hilfe
Wählen Sie einen Buchstaben aus der alphabetischen Liste und klicken Sie darauf, um Wirkstoffe zu erhalten, die mindestens eine Orphan-Designation aufweisen. Die zugehörigen geografischen Gebiete sind angegeben. Klicken Sie anschließend auf den Wirkstoff, um das „Wirkstoff-Infoblatt“ aufzurufen, oder klicken Sie auf ein Gebiet, um detaillierte Informationen über die Designation in dieser Region zu erhalten.
Das Verzeichnis der Orphan Drugs umfasst alle Substanzen, die mit einer Orphan-Designation für seltene Krankheiten in Europa ausgewiesen sind, unabhängig davon, ob sie einer Weiterentwicklung unterliegen, die eine Marktzulassung (MA) ermöglicht.
Die vorliegenden Angaben basieren auf amtlichen Datenquellen.
Auskünfte über europäische oder amerikanische Arzneimittel mit Orphan-Designation können über die nachfolgenden Links aufgerufen werden:
http://ec.europa.eu/health/documents/community-register/html/alforphreg.htm(Europa)
http://www.fda.gov/ForIndustry/DevelopingProductsforRareDiseasesConditions/HowtoapplyforOrphanProductDesignation/default.htm (USA)
Orphanet dankt der Europäischen Arzneimittel-Agentur (EMA) für die Unterstützung bei der Erstellung der Datenbank für Arzneimittel in Europa, die als Orphan Medicinal Product für seltene Krankheiten ausgewiesen sind. Das Projekt wurde an der EMA von dem Ausschuss für Arzneimittel für seltene Krankheiten (COMP; Committee for Orphan Medicinal Products)initiiert. Einige Mitglieder der COMP-Arbeitsgruppe haben einen individuellen Beitrag zur Entwicklung der Datenbank geleistet, die von den COMP Mitgliedern als wichtiges Werkzeug für alle Interessengruppen begrüßt wurde. Die Datenbank wurde unabhängig und in seiner Gesamtheit von Orphanet erstellt. Die Finanzierung erfolgte mit öffentlichen und privaten Fördermitteln. Aus den genannten Gründen ist weder die EMA noch die COMP für den Inhalt oder die Verwaltung der Datenbank verantwortlich
Die Entwicklung der Orphanet-Datenbank für Orphan Drugs wurde durch die Kofinanzierung der nachfolgenden Institutionen und Unternehmen ermöglicht:







Orphan-Designation nach Geografischer Verbreitung
- AASSGVSTPGSAGHDIITEQPRS (P42 peptide)
- AB8939
- Abagovomab
- Acalabrutinib
- Acamprosat calcium
- Acebutolol
- Acetazolamide
- Acetylcysteine
- Acetylleucine
- Acetylsalicylic acid
- Ad5/3-D24-granulocyte-macrophage colony stimulating factor (GMCSF)-encoding oncolytic adenovirus
- Adalimumab
- Adeno-associated viral (AAV) vector expressing human retinoschisin-1 gene
- Adeno-associated viral vector containing a modified U7-snRNA gene
- Adeno-associated viral vector expressing acid alpha-glucosidase gene
- Adeno-associated viral vector expressing human 21-hydroxylase
- Adeno-associated viral vector expressing lipoprotein lipase
- Adeno-Associated Viral Vector (FLT180a) carrying the Factor IX gene
- Adeno-associated viral vector serotype 10 carrying the human N-sulfoglucosamine sulfohydrolase cDNA
- Adeno-associated viral vector serotype 2/6 encoding zinc-finger nucleases and the human alpha L-iduronidase gene
- Adeno-associated viral vector serotype 2/6 encoding zinc-finger nucleases and the human iduronate 2-sulfatase gene
- Adeno-associated viral vector serotype 2.7m8 containing the ChrimsonR-tdTomato gene
- Adeno-associated viral vector serotype 2 containing the human Rab escort protein 1 gene
- Adeno-associated viral vector serotype 3B encoding human multidrug resistance protein 3A
- Adeno-associated viral vector serotype 3B encoding shortened human ATP7B
- Adeno-associated viral vector serotype 5 containing a B-domain deleted variant of human coagulation factor VIII gene
- Adeno-associated viral vector serotype 5 containing the human CHM gene
- Adeno-associated viral vector serotype 5 containing the human RLBP1 gene
- Adeno-associated viral vector serotype 5 encoding a microRNA targeted to human huntingtin gene
- Adeno-associated viral vector serotype 8 containing a functional copy of the codon-optimised F8 cDNA encoding the B-domain deleted human coagulation factor VIII
- Adeno-associated viral vector serotype 8 containing the human acid alpha-glucosidase gene
- Adeno-associated viral vector serotype 8 containing the human alpha-galactosidase A gene
- Adeno-associated viral vector serotype 8 containing the human CNGA3 gene under the control of a cone arrestin promoter
- Adeno-associated viral vector serotype 8 containing the human factor-VII gene
- Adeno -associated viral vector serotype 8 containing the human functional version of UGT1A1 gene
- adeno-associated viral vector serotype 8 containing the human glucose-6-phosphatase gene
- Adeno-associated viral vector serotype 8 containing the human MTM1 gene
- Adeno-associated viral vector serotype 8 encoding engineered rhodopsin DNA-binding repressor and human rhodopsin expression cassettes
- Adeno-associated viral vector serotype 8 encoding human ornithine transcarbamylase
- adeno-associated viral vector serotype 8 encoding the human ATP7B gene under the control of the human alpha-1 antitrypsin promoter
- Adeno-associated viral vector serotype 9 containing the human CLN1 gene
- adeno-associated viral vector serotype 9 containing the human HGSNAT gene
- Adeno-associated viral vector serotype 9 containing the human iduronate-2-sulfatase gene
- Adeno-associated viral vector serotype 9 containing the human mini-dystrophin gene
- Adeno-associated viral vector serotype 9 containing the human SMN gene
- Adeno-associated viral vector serotype 9 encoding a codon-optimised human aspartylglucosaminidase transgene
- Adeno-associated viral vector serotype 9 encoding human ATP7B
- adeno-associated viral vector serotype 9 encoding miRNA against human superoxide dismutase 1
- Adeno-associated viral vector serotype 9 expressing codon-optimized human GRN gene
- Adeno-associated viral vector serotype Anc80 containing the truncated human ATP7B gene under the control of the human alpha-1 antitrypsin promoter
- Adeno-associated viral vector serotype hu68 containing the human SMN1 gene
- Adeno-associated viral vector serotype LK03 encoding human ornithine transcarbamylase
- Adeno-associated viral vector serotype rh10 containing the human cholesterol 24-hydroxylase gene
- Adeno-associated viral vector serotype rh.10 expressing beta-galactosidase
- Adeno-associated viral vector serotype S3 encoding human alpha-galactosidase A cDNA
- adeno-associated virus serotype 2/6 encoding human alpha-galactosidase A cDNA
- Adeno-associated virus serotype 2/8 vector containing the human PDE6A gene
- Adeno-associated virus serotype 5 containing the human RDH12 gene
- Adeno-associated virus serotype 8 containing the human RdCVF sequence and the human RdCVFL sequence
- Adeno-associated virus serotype 9 containing the human ASPA gene
- Adeno-associated virus serotype 9 expressing the human Survival Motor Neuron gene
- adeno-associated virus serotype 9 vector containing human n-acetylgalactosamine-6-sulfate sulfatase gene
- Adeno-associated virus serotype HSC15 expressing human arylsulfatase A gene
- Adeno-associated virus serotype HSC15 expressing human phenylalanine hydroxylase
- Adeno-associated virus serotype hu68 containing the human GLB1 gene
- Adeno-associated virus serotype rh74 containing the human micro-dystrophin gene
- Adeno-associated virus serotype rh74 containing the human sarcoglycan beta gene
- Adenoassociated virus vector (AAV) carrying a modified AAV serotype 2 backbone and coding sequence of human thymidine phosphorylase preceded by a human thyroxin-binding globulin promoter
- adeno-associated virus vector encoding human phenylalanine hydroxylase
- adeno associated virus with modified transthyretin and sequence encoding factor IX variant gene
- Adeno-assoziierter viraler Vektor 2, der das menschliche Gen CHM enthält, das für das Rab Begleitprotein 1 kodiert
- Adeno-assoziierter viraler Vektor, der das Gen Porphobilinogen Deaminase enthaelt
- Adeno-assoziierter viraler Vektor, der das humane Faktor-IX-Gen enthält
- Adeno-assoziierter viraler Vektor mit humanem ARSB Gen
- Adeno-assoziierter viraler Vektor mit humanem NADH-Dehydrogenase-4-Gen
- Adeno-assoziierter viraler Vektor Serotyp 9, der das Gen für humanes kardiales Calsequestrin enthält
- Adeno-assoziierter Virusvektor, der das humane a-N-Acetylgalactosaminidase Gen trägt
- Adeno-assoziierter Virusvektor des Serotyps 9, der das humane Sulfamidase-Gen enthält
- Adeno-assoziierter Virusvektor Serotyp 2, der das humane REP1 Gen enthält
- Adeno-assoziierter Virusvektor Serotyp 9, der das humane N-Acetylgalactosaminidase alpha Gen enthält
- Adeno-assoziierte virale Vektoren, welche ein modifiziertes U1-snRNA Gen enthalten
- Adenoviral vector containing human p53 gene
- Adenoviral vector of serotype 5 modified to contain a chimeric sequence consisting of a minimal urokinase-type plasminogen activator receptor promoter preceded by three Notch-responsive elements, and coated with oligopeptide end-modified poly (beta-amino) esters
- Adenoviral vector serotype 5 containing the vascular endothelial growth factor D isoform (preprocessed short form) from a CMV promoter
- Adenoviral vector serotype 5 encoding the human interleukin-12 p70 transgene
- Adenovirus associated viral vector serotype 2/8 containing the human CNGA3 gene
- Adenovirus associated viral vector serotype 4 containing the human RPE65 gene
- Adenovirus associated viral vector serotype 5 containing the human RPE65 gene
- adenovirus associated viral vector serotype 5 containing the RPGR gene
- Adenovirus associated viral vector serotype 8 containing the human CNGB3 gene
- Adenovirus-associated viral vector serotype 8 containing the human RPGR gene
- Adenovirus-assoziierter Vektor, der das humane Fas-c Gen enthält
- Adenovirus-assoziierter viraler Vektor Serotyp 2, der das humane RPE65 Gen enthält
- Adenovirus-assoziierter viraler Vektor, Serotyp 4, der cDNAs der humanen N-Sulfoglycosamine-Sulphohydrolase und des Sulfatase-modifizierenden Faktors 1 transportiert
- Adenovirus-assoziierter viraler Vektor vom Serotyp 5, der das humane pde6beta Gen enthält
- Adenovirus delta 24-RGD
- Adenovirus-mediated Herpes Simplex Virus-thymidine kinase gene
- A-dmDT390-bisFv(UCHT1)
- Adrenomedullin
- Adult human bone-marrow-derived, ex-vivo-expanded, pooled allogeneic mesenchymal stromal cells
- Afamelanotid
- Afatinib
- Agalsidase alfa
- Agalsidase beta
- A highly purified formulation of Staphylococcus aureus protein A
- Albendazol
- Albumingebundene Nanopartikel-Formulierung von Paclitaxel
- Aldesleukin
- Aldoxorubicin
- Alemtuzumab
- A lentiviral vector pseudotyped by the Indiana serotype of the vesicular stomatitis virus G protein encoding an antigen derived from the Tax, HBZ, p12I and p30II HTLV-1 proteins
- A lentiviral vector pseudotyped by the New-Jersey serotype of the vesicular stomatitis virus G protein encoding an antigen derived from the Tax, HBZ, p12I and p30II HTLV-1 proteins
- Alginate oligosaccharide (G-block) fragment
- Alglucerase
- Alglucosidase alfa
- Alicaforsen
- Alirocumab
- Alisitol, retinol palmitate, zinc gluconate
- Alitretinoin
- A live attenuated bioengineered Listeria monocytogenes cancer immunotherapy
- Allantoin
- All-cis-docosa-4,7,10,13,16,19-hexaenoic acid
- allium(68Ga)-N-[(4,7,10-Tricarboxymethyl-1,4,7,10-tetraazacyclododec-1-yl)acetyl]-D-phenylalanyl-L-cysteinyl-L-tyrosyl-D-tryptophanyl-L-lysyl-L-threoninyl-L-cysteinyl-L-threonin-cyclisches(2-7)Disulfid
- Allogene, aus dem Knochenmark stammende mesenchymale Zellen, die ex vivo in synthetischen Medien vermehrt wurden
- Allogene ex vivo expandierte Nabelschnurblutzellen
- Allogene, humane, dermale Fibroblasten
- Allogeneic ABCB5-positive limbal stem cells
- Allogeneic adipose-derived adult mesenchymal stem cells contained in a fibrin-based bioengineered dermis
- Allogeneic bone marrow derived mesenchymal stromal cells, ex-vivo expanded
- Allogeneic CD34+ cells expanded ex vivo with an aryl hydrocarbon receptor antagonist
- Allogeneic CD4+ and CD25+ T lymphocytes ex vivo incubated with GP120
- Allogeneic cultured postnatal thymus-derived tissue
- Allogeneic donor-derived ex-vivo expanded T lymphocytes transduced with a retroviral vector containing inducible caspase 9 and truncated CD19
- Allogeneic Epstein-Barr virus specific cytotoxic T lymphocytes
- Allogeneic ex-vivo-expanded human umbilical cord blood-derived mesenchymal stem cells
- Allogeneic ex-vivo-expanded umbilical cord blood-derived haematopoietic CD34+ progenitor cells and allogeneic non-expanded umbilical cord blood-derived haematopoietic mature myeloid and lymphoid cells
- Allogeneic ex vivo-generated natural killer cells from CD34+ umbilical cord blood progenitor cells
- Allogeneic fecal microbiota
- Allogeneic fetal human retinal progenitor cells expanded ex vivo
- Allogeneic hepatoblastoma cells encapsulated in alginate, ex vivo expanded
- Allogeneic multi-virus specific T lymphocytes targeting BK virus, cytomegalovirus, human herpesvirus-6, Epstein Barr virus and adenovirus
- Allogeneic peripheral blood mononuclear cells incubated ex-vivo with 16, 16-dimethyl prostaglandin E2 and dexamethasone
- Allogeneic peripheral blood mononuclear cells induced to an early apoptotic state
- Allogeneic retinal epithelial cells transfected with plasmid vector expressing ciliary neurotrophic growth
- Allogeneic retinal pigment epithelial cells genetically modified with a non-viral vector to express beta-domain deleted human factor VIII
- Allogeneic skin-derived ABCB5-positive mesenchymal stem cells
- Allogeneic T-cell precursors, mobilised peripheral blood-derived, ex vivo cultured
- Allogeneic umbilical cord tissue-derived mesenchymal stromal cells ex vivo expanded
- Allogene, in-vitro vermehrte, neuronale Vorläuferzellen der Netzhaut, die aus der neuronalen Retina gewonnen wurden
- Allogene Progenitorzellen für Motorneurone, abgeleitet von menschlichen embryonalen Stammzellen
- Allogene T-Zellen, die ein exogenes TK Gen encodieren
- Allogenic cytomegalovirus-specific cytotoxic T lymphocytes
- Allopregnanolone
- Allopurinol
- Alpelisib
- Alpha-1 antitrypsin (inhalation use)
- Alpha-1 proteinase inhibitor (inhalation use)
- Alpha galactosidase A
- Alpha-tocopherol
- Alpha-tocopherol and ascorbic acid
- Alpha-Tocotrienol Chinon
- Altiratinib
- Alvocidib
- Amatuximab
- Ambrisentan
- Ambroxol hydrochloride
- Amikacinsulfat
- Amikacin sulfate (liposomal)
- Ammonium tetrathiomolybdate
- Amphotericin B
- [a-N-(2'succinyl-paclitaxel)Thr]-Phe-Phe-Tyr-Gly-Gly-Ser-Arg-Gly-[epsilon-N-(2'succinyl-paclitaxel)Lys]-Arg-Asn-Asn-Phe-[epsilon-N-(2'succinyl-paclitaxel)Lys]-Thr-Glu-Glu-Tyr
- Anagrelid
- Anakinra
- Aninosalicylsäure
- Anlotinib
- Antagonist of the complement 5a receptor
- Anti-Beta1 integrin monoclonal antibody
- Antibody drug conjugate consisting of fully human anti-guanylyl cyclase C monoclonal antibody linked to the cytotoxic drug monomethyl auristatin E
- Anti-D-Immunglobulin vom menschen
- Anti-(endothelin-1 receptor subtype A) IgG4 humanised monoclonal antibody
- Anti-EphA2 monoklonaler Antikörper konjugiert mit Maleimidocaproyl-Monomethylauristatin-Phenylalanin
- Anti-epithelial cell adhesion molecule / anti-CD3 monoclonal antibody
- Anti-GD2 monoclonal antibody 3F8 humanised
- Antihemophilic factor / Von Willebrand factor complex (human)
- anti-(integrin beta-3) human monoclonal antibody
- Anti-(pancreatic adenocarcinoma upregulated factor) IgG1 humanised monoclonal antibody
- Antisense NF-kappaB p65 Oligonucleotide
- Antisense oligonucleotide 5'-d[P-Thio} (CCCTG CTCCC CCCTG GCTCC)-3'
- Antisense oligonucleotide complementary to the exonic splicer enhancer sequence at intron 26 of the centrosomal protein 290 pre-mRNA
- Antisense oligonucleotide targeting exon 13 in the USH2A gene
- Antisense oligonucleotide targeting exon 73 in the COL7A1 gene
- Antisense oligonucleotide targeting the USH2A gene
- Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
- Antisense-Oligonukleotide, die auf die F508del-Mutation des CFTR-Gens abzielen
- Antisense-Oligonukleotid gegen das SMN2-Gen
- Antithrombin alfa
- Antithrombin III vom menschen
- Anti-tumor necrosis factor polyclonal antibody (bovine)
- Antroquinonol
- Apatinib mesylate
- Aplidine
- Apolipoprotein C-III spezifisches Phosphortioat-Oligonukleotid
- Apomorphinhydrochlorid
- Apomorphinhydrochlorid (zur Inhalation)
- Apraglutide
- Apremilast
- Argon
- Arimoclomol
- Arimoclomol citrate
- Arsentrioxyde
- Artemether/lumefantrine
- Artesunat
- Asciminib
- Ascorbic acid
- Aspacytarabine
- Asp-Arg-Val-Tyr-Ile-His-Pro
- Ataluren
- Atovaquon
- Atrasentan
- Auf die A1-Domäne des humanen von Willebrand Faktors gerichteter Nanobody
- Auf einem Adeno-assoziierten Virus serotyp 2 Plasmid basierender Vektor mit pseudo-serotyp Typ 8 Kapsid, der unter der Kontrolle des menschlichen Thyroxin-bindenden Globulin Promoters fuer das menschliche TYMP Gen kodiert
- Aus dem Knochenmark gewonnene, allogene, ex vivo expandierte, multipotente Vorläuferzellen
- Aus einer CD34 + Vorläuferzellen Zelllinie abgeleitete allogene humane dendritische Zellen
- Aus Glioblastom gewonnene allogene und autologe haptenisierte und bestrahlte Zellen und Zelllysate
- Aus Lebergewebe isolierte heterologe adulte humane Stammzellen
- Autologe CD34+ hämatopoetische Stammzellen, die mit einem lentiviralen Vektor transduziert sind, der für das humane BetaA-T87Q-globin Gen kodiert
- Autologe CD34+-Zellen mit einem lentiviralen Vektor transduziert, der das menschliche Gen SGSH enthält
- Autologe CD34+ Zellen, transduziert mit einem lentiviralen Vektor, der das menschliche RAG1-Gen enthält
- Autologe CD34+ Zellen, transfiziert mit lentiviralen Vektoren, die das Gen des humanen Wiskott Aldrich Syndrom Proteins enthalten
- Autologe CD34+ Zellen, transfiziert mit lentiviralen Vektoren, die das menschliche ADA-Gen enthalten
- Autologe dendritische Zellen, die mit allogenem Tumorzelllysat behandelt wurden
- Autologe dendritische Zellen, die mit an oxidierter Polymannose gebundenem rekombinanten humanen Fusionsprotein (Mucin-1-glutathione-S-Transferase) behandelt wurden
- Autologe dendritische Zellen, die mit Gliomastammzellen-RNS behandelt wurden
- Autologe dendritische Zellen, die mit synthetischen Peptiden aus Tumorantigenen (MAGE-1, HER-2, AIM-2, TRP-2, gp100 und Interleukin-13-Rezeptor alpha) beladen ("gepulst") wurden
- Autologe ex-vivo expandierte mit 5-Aza-2'-Deoxycytidin behandelte Leukozyten
- Autologe hämatopoetische Stammzellen, die mit einem lentiviralen Vektor (Lenti-D) transduziert sind ; dieser kodiert fuer die humane cDNA des ABCD1 Gens
- Autologe hämatopoetische Stammzellen , die mit einem lentiviralen Vektor transduziert sind, der das humane Betaglobingen kodiert
- Autologe hämatopoetische Zellen, genetisch modifiziert mit einem lentiviralen-Vektor, der das humane gp91(phox) Gen enthält
- Autologer, aus Tumorzellen gewonnener gp96 Hitzeschock-Protein-Peptidkomplex
- Autologe regulatorische T-Zellen mit Immunphänotyp CD4+CD25hi+FoxP3+
- Autologer tumoraler Immunglobulin-Idiotyp KLH gekoppelt an Megathura crenulata (keyhole limpet) Haemocyanin
- Autologe, von Knochenmark abgeleitete mesenchymale Stromazellen, die neurotrophe Faktoren sezernieren
- Autologous adipose derived mesenchymal stromal cells
- Autologous adipose tissue-derived mesenchymal stem cells
- autologous adipose tissue-derived stromal vascular fraction cells
- autologous adult bone marrow-derived non-expanded CD133+ haematopoietic stem cells for the treatment of Asherman's syndrome
- Autologous adult live cultured osteoblasts
- autologous bone marrow CD34+ cells transduced ex vivo with a self activating HIV-1 -based lentiviral vector, EFS-ADA
- Autologous bone marrow derived CD34+ cells transduced ex vivo with a self-inactivating lentiviral vector containing a normal version of the coding region of the IL2RG gene
- autologous CD34+ cells transduced ex vivo with a lentiviral vector containing a modified gamma-globin gene
- Autologous CD34+ cells transduced with a lentiviral vector encoding galactosidase alpha
- Autologous CD34+ cells transduced with a lentiviral vector encoding glucosylceramidase beta
- Autologous CD34+ cells transduced with lentiviral vector encoding the human beta globin gene
- Autologous CD34+ cells transduced with the W1.6_hWASP_WPRE lentiviral vector
- Autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase AcDNA
- Autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene
- autologous CD34+ haematopoietic stem and progenitor cells genetically modified with the lentiviral vector IDUA LV, encoding for the alpha-L-iduronidase cDNA
- Autologous CD34+ hematopoietic stem cells transduced with LentiGlobin BB305 lentiviral vector encoding the human BA-T87Q-globin gene
- autologous CD34+ hematopoietic stem cells with a CRISPR-edited erythroid enhancer region of the BCL11A gene
- Autologous CD3+ T cells transduced with retroviral vector containing a chimeric antigen receptor directed against CD19 (Autologous CD3+ T cells containing CD19 chimeric antigen receptor)
- Autologous CD4+ and CD8+ T cells expressing a CD19-specific chimeric antigen receptor
- Autologous CD4+ and CD8+ T cells transduced with a lentiviral vector encoding an affinity enhanced T cell receptor specific to MAGE-A4
- autologous CD4+ and CD8+ T cells transduced with lentiviral vector containing an affinity-enhanced T-cell receptor targeting the New York esophageal antigen-1
- autologous, CRISPR gene-edited hematopoietic stem cell
- Autologous cultured endothelial cells on a donor human corneal disk
- Autologous dendritic cells incubated ex vivo with zebularine and factor VIII
- Autologous dendritic cells pulsed with autologous cell lysate
- autologous dendritic cells pulsed with killed ovarian cancer cells and matured by TLR3 ligand ex vivo
- Autologous Epstein-Barr virus specific T cells derived from peripheral blood mononuclear cells, expanded ex vivo-
- Autologous ex-vivo-expanded peripheral polyclonal lymphocytes enriched in activated natural killer cells
- Autologous genetically modified human dermal fibroblasts
- Autologous glioma tumour cells treated with antisense molecule directed against the insulin-like growth factor type 1 receptor
- Autologous human adipose perivascular stromal cells genetically modified to secrete soluble tumour necrosis factor-related apoptosis-inducing ligand
- Autologous human bone marrow-derived haematopoietic and mesenchymal stem cells depleted of erythrocytes, monocytes and lymphocytes
- Autologous human peripheral blood Vdelta1+ T lymphocytes activated in vitro by cytokine and monoclonal antibody treatment
- Autologous human T cells genetically modified ex-vivo with a lentiviral vector encoding a chimeric antigen receptor for B-cell maturation antigen
- Autologous mesenchymal stromal cells on a decellularised tracheal scaffold from a cadaveric donor
- Autologous mononuclear cells derived from human cord blood
- Autologous Olfactory Neural Progenitors
- Autologous peripheral blood T lymphocytes transduced with retroviral vector containing anti CD19 CD28/CD3 zeta chimeric antigen receptor
- Autologous renal cell tumor vaccine
- Autologous skin equivalent graft composed of keratinocytes and fibroblasts genetically corrected by CRISPR/Cas9-mediated excision of mutation-carrying COL7A1 exon 80
- Autologous T Cells transduced with lentiviral vector containing a chimeric antigen receptor directed against CD19
- Autologous T cells transduced with lentiviral vector containing a tandem chimeric antigen receptor directed against CD20 and CD19
- Autologous T-cells transduced with lentiviral vector encoding an anti-SLAMF7 CD28/CD3-zeta chimeric antigen receptor
- Autologous T lymphocyte-enriched population of cells transduced with a lentiviral vector encoding a chimeric antigen receptor targeting human B cell maturation antigen with 4-1BB and CD3-zeta intracellular signalling domains
- Avatrombopag
- Avian polyclonal IgY antibody against Pseudomonas aeruginosa
- Aviptadil
- Azacitidine
- Aztreonam lysinate (inhalation use)