x

Search for an orphan drug

* (*) mandatory field

Other search option(s)

Orphan designation - Europe

  • Substance: Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
  • ATC code : -
  • EU Number: EU/3/03/161
  • Designation date : 02/10/2003
  • Sponsor of orphan designation : GENE SIGNAL SAS
  • Summary of Opinion

Designation

Treatment of neovascular glaucoma.

Diseases list

The documents contained in this web site are presented for information purposes only. The material is in no way intended to replace professional medical care by a qualified specialist and should not be used as a basis for diagnosis or treatment.