x

Cerca un farmaco orfano

* (*) campo obbligatorio

Altra/e opzione/i di ricerca

Designazione orfana - Europa

  • Sostanza: Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
  • Codice ATC : -
  • Numero EU: EU/3/07/445
  • Data della designazione : 17/04/2007
  • Sponsor dell Designazione orfana: GENE SIGNAL SAS
  • Indagine Pubblica di Opinione

Designation

Prevention of corneal graft rejection.

Tutte le informazioni presenti nel sito non sostituiscono in alcun modo il giudizio di un medico specialista, l'unico autorizzato ad effettuare una consulenza medica ed esprimere un parere medico.