x

Zoek een weesgeneesmiddel

* (*) verplicht veld

Andere zoekoptie(s)

Aanduiding als weesgeneesmiddel - Europa

  • Stof : Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
  • ATC-code : -
  • EU-nummer : EU/3/07/445
  • Aanwijzingsdatum : 17/04/2007
  • Sponsor aanwijzing als weesgeneesmiddel : GENE SIGNAL SAS
  • Samenvatting van het advies

DESIGNATION

Prevention of corneal graft rejection.

De documenten op deze website zijn louter ter informatie. Het materiaal is geenszins bestemd om professionele medische zorgen door een gediplomeerde specialist te vervangen en mag niet worden gebruikt als basis voor een diagnose of behandeling.