Účinné látky

• (S)-perillyl alcohol temozolomide
• 1,2:5,6-Dianhydrogalactitol
• 18-(p-[124I]-iodophenyl)octadecyl phosphocholine
• 2-hydroxyoleic acid
• 4,6,8-trihydroxy-10-(3,7,11-trimethyldodeca-2,6,10-trienyl)-5,10-dihydrodibenzo[b,e][1,4] diazepin-11-one
• 4-[123I] iodo-L-phenylalanine
• 4-[131I] iodo-L-phenylalanine
• 5-aminolevulinic acid hydrochloride
• 7-beta-hydroxycholesteryl-3-beta-oleate
• Adenoviral vector serotype 5 encoding the human interleukin-12 p70 transgene
• Adenovirus serotype 5 containing partial E1A deletion and an integrin-binding domain
• Adenovirus-associated vector containing human Fas-c gene (Ofranergene obadenovec)
• Adenovirus-mediated Herpes Simplex Virus-thymidine kinase (HKSV-tk) gene
• Allogeneic and autologous haptenised and irradiated cells and cell lysates derived from glioma
• Asunercept
• Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex
• Autologous dendritic cells pulsed with RNA from glioma stem cells
• Autologous dendritic cells pulsed with autologous cell lysate
• Autologous dendritic cells pulsed with tumour antigen-derived synthetic peptides (MAGE-1, HER-2, AIM-2, TRP-2, gp-100, and interleukin-13 receptor alpha)
• Autologous ex-vivo-expanded leucocytes treated with 5-aza-2'-deoxycytidine
• Autologous glioma tumour cells treated with antisense molecule directed against the insulin-like growth factor type 1 receptor
• Biotinylated anti-tenascin monoclonal antibody for use with 90-Yttrium
• Boswellia serrata resin dry extract
• Cannabidiol
• Carmustine
• Carmustine (solution for intratumoral injection)
• Cilengitide
• Combination of carboplatin and sodium valproate
• Copper (64Cu) chloride
• Dabrafenib Mesylate
• Delta-9-tetrahydrocannabinol and cannabidiol from extracts of the Cannabis sativa L. plant
• Doxorubicin (administered after synthetic double-stranded siRNA oligonucleotide directed against claudin-5 complexed with polyethyleneimine)
• Doxorubicin hydrochloride (drug eluting beads)
• Dronabinol and cannabidiol
• Eflornithine
• Enzastaurin hydrochloride
• Erlotinib
• Florilglutamic acid (18F)
• Fluciclovine (18F)
• Flucytosine
• Gadodiamide (liposomal)
• Galunisertib
• Gimatecan
• Glutathione-pegylated liposomal doxorubicin hydrochloride
• H-Arg-Pro-Lys-Pro-Gln-Gln-Phe-2Thi-Gly-Leu-Met(O2)-NH2-DOTA-213-bismuth
• H-Arg-Pro-Lys-Pro-Gln-Gln-Phe-2Thi-Gly-Leu-Met(O2)-NH2-DOTA-225-Actinium
• Herpes simplex virus lacking infected cell protein 34.5
• Human interleukin 12 fused with immunoglobulin G4 C-terminal Fc fragment
• Human transferrin conjugated to mutant diphtheria toxin
• Humanised monoclonal antibody against epidermal growth factor receptor
• Humanised recombinant monoclonal antibody against epidermal growth factor receptor conjugated to maleimidocaproyl monomethylauristatin F
• IL-12-secreting dendritic cells, loaded with autologous tumour lysate
• Iodine (131I) anti-nucleohistone H1 chimeric biotinylated monoclonal antibody
• Iodine (131I) anti-tenascin monoclonal antibody 81C6
• Iodine (131I) chlorotoxin
• Irinotecan hydrochloride (drug eluting beads)
• L-cysteine, L-leucyl-L-alpha-glutamyl-L-alpha-glutamyl-L-lysyl-L-lysylglycyl-L-asparaginyl-L-tyrosyl-L-valyl-L-valyl-L-threonyl-L-alpha-aspartyl-L-histidyl-S-[1-[(4-carboxycyclohexyl)methyl]-2,5-dioxo-3-pyrrolidinyl]-complex with keyhole limpet haemocyanin
• Larotrectinib
• Marizomib
• N-(4-Methoxyphenyl)-N,2,6-trimethylfuro[2,3-d]pyrimidin-4-amine
• Nimotuzumab
• Oligonucleotide phosphorothioate (TAAACGTTATAACGTTATGACGTCAT)
• Onfekafusp alfa
• Paclitaxel-succinate-Arg-Arg-Leu-Ser-Tyr-Ser-Arg-Arg-Arg-Phe
• Picropodophyllin
• Pritumumab
• Pseudomonas exotoxin (domains II/III)-Interleukin 13 chimeric protein
• Recombinant fusion protein of circulary-permuted IL-4 and pseudomonas exotoxin A, [IL-4(38-37)-PE38KDEL]
• Recombinant human bone morphogenetic protein 4
• Regorafenib
• Salmonella typhi Ty21a strain transfected with a plasmid vector encoding the human vascular endothelial growth factor receptor 2
• Synthetic double-stranded siRNA oligonucleotide directed against claudin-5 complexed with polyethyleneimine (prior to administration of doxorubicin)
• Talampanel
• Technetium (99mTc) tetrofosmin
• Temozolomide
• Topotecan hydrochloride (liposomal)
• Trabedersen
• Veledimex
• Vocimagene amiretrorepvec
• Zoledronic acid
• Zotiraciclib
• trametinib dimethyl sulfoxide

Obchodní název

• BICNU
• GLIADEL