Orphanet: Wyszukaj lek sierocy
Wyszukaj lek sierocy
84 Wyniki
(S)-perillyl alcohol temozolomide 1,2:5,6-Dianhydrogalactitol 18-(p-[124I]-iodophenyl)octadecyl phosphocholine 2-hydroxyoleic acid 4,6,8-trihydroxy-10-(3,7,11-trimethyldodeca-2,6,10-trienyl)-5,10-dihydrodibenzo[b,e][1,4] diazepin-11-one 4-[123I] iodo-L-phenylalanine 4-[131I] iodo-L-phenylalanine 5-aminolevulinic acid hydrochloride 7-beta-hydroxycholesteryl-3-beta-oleate Adenoviral vector serotype 5 encoding the human interleukin-12 p70 transgene Adenovirus serotype 5 containing partial E1A deletion and an integrin-binding domain Adenovirus-associated vector containing human Fas-c gene Adenovirus-mediated Herpes Simplex Virus-thymidine kinase (HKSV-tk) gene Allogeneic and autologous haptenised and irradiated cells and cell lysates derived from glioma Asunercept Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex Autologous dendritic cells pulsed with RNA from glioma stem cells Autologous dendritic cells pulsed with autologous cell lysate Autologous dendritic cells pulsed with tumour antigen-derived synthetic peptides (MAGE-1, HER-2, AIM-2, TRP-2, gp-100, and interleukin-13 receptor alpha) Autologous ex-vivo-expanded leucocytes treated with 5-aza-2'-deoxycytidine Autologous glioma tumour cells treated with antisense molecule directed against the insulin-like growth factor type 1 receptor Bevacizumab Biotinylated anti-tenascin monoclonal antibody for use with 90-Yttrium Boswellia serrata resin dry extract Cannabidiol Carmustine Carmustine (solution for intratumoral injection) Cilengitide Combination of carboplatin and sodium valproate Delta-9-tetrahydrocannabinol and cannabidiol from extracts of the Cannabis sativa L. plant Doxorubicin (administered after synthetic double-stranded siRNA oligonucleotide directed against claudin-5 complexed with polyethyleneimine) Doxorubicin hydrochloride (drug eluting beads) Dronabinol and cannabidiol Eflornithine Enzastaurin hydrochloride Erlotinib hydrochloride Florilglutamic acid (18F) Fluciclovine (18F) Flucytosine Gadodiamide (liposomal) Galunisertib Gimatecan Glutathione-pegylated liposomal doxorubicin hydrochloride H-Arg-Pro-Lys-Pro-Gln-Gln-Phe-2Thi-Gly-Leu-Met(O2)-NH2-DOTA-213-bismuth H-Arg-Pro-Lys-Pro-Gln-Gln-Phe-2Thi-Gly-Leu-Met(O2)-NH2-DOTA-225-Actinium Herpes simplex virus lacking infected cell protein 34.5 Human transferrin conjugated to mutant diphtheria toxin Humanised monoclonal antibody against epidermal growth factor receptor Humanised recombinant monoclonal antibody against epidermal growth factor receptor conjugated to maleimidocaproyl monomethylauristatin F IL-12-secreting dendritic cells, loaded with autologous tumour lysate Iodine (131I) anti-nucleohistone H1 chimeric biotinylated monoclonal antibody Iodine (131I) anti-tenascin monoclonal antibody 81C6 Iodine (131I) chlorotoxin Irinotecan hydrochloride (drug eluting beads) L-cysteine, L-leucyl-L-alpha-glutamyl-L-alpha-glutamyl-L-lysyl-L-lysylglycyl-L-asparaginyl-L-tyrosyl-L-valyl-L-valyl-L-threonyl-L-alpha-aspartyl-L-histidyl-S-[1-[(4-carboxycyclohexyl)methyl]-2,5-dioxo-3-pyrrolidinyl]-complex with keyhole limpet haemocyanin Larotrectinib Marizomib N-(4-Methoxyphenyl)-N,2,6-trimethylfuro[2,3-d]pyrimidin-4-amine Nimotuzumab Oligonucleotide phosphorothioate (TAAACGTTATAACGTTATGACGTCAT) Onfekafusp alfa Paclitaxel-succinate-Arg-Arg-Leu-Ser-Tyr-Ser-Arg-Arg-Arg-Phe Picropodophyllin Pritumumab Pseudomonas exotoxin (domains II/III)-Interleukin 13 chimeric protein Recombinant fusion protein of circulary-permuted IL-4 and pseudomonas exotoxin A, [IL-4(38-37)-PE38KDEL] Recombinant human bone morphogenetic protein 4 Regorafenib Salmonella typhi Ty21a strain transfected with a plasmid vector encoding the human vascular endothelial growth factor receptor 2 Synthetic double-stranded siRNA oligonucleotide directed against claudin-5 complexed with polyethyleneimine (prior to administration of doxorubicin) Talampanel Technetium (99mTc) tetrofosmin Temozolomide Topotecan hydrochloride (liposomal) Trabedersen Tranilast Veledimex Vocimagene amiretrorepvec Zoledronic acid Zotiraciclib
