Orphanet: Wyszukaj lek sierocy
Wyszukaj lek sierocy
184 Wyniki
- (2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro-1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid
- (3S)-(+)-(5-chloro-2-methoxyphenyl)-1,3-dihydro-3-fluoro-6-(trifluoromethyl)-2H-indol-2-one
- (7S)-8,8-dimethyl-7-{[(2E)-3-phenyl-2-propen-1-yl]oxy}-7,8-dihydro-2H,6H-pyrano[3,2-g]chromen-2-on
- (R)-3-(1-(2,3-dichloro-4-(pyrazin-2-yl)phenyl)-2,2,2-trifluoroethyl)-1-methyl-1-(1-methylpiperidin-4-yl)urea fumarate
- (S)-1-(4-(1-(3,4,5-trimethoxyphenyl)-1H-imidazol-4-ylamino)thieno[2,3-d]pyrimidin-2-yl)pyrrolidine-2-carboxamide
- (S)-6-hydroxy-2,5,7,8-tetramethyl-N-((R)-piperidin-3-yl)chroman-2-carboxamide hydrochloride
- 2-[4-[3-(methylamino)-1-phenylpropoxy]phenyl]ethanol hydrochloride
- 2-isopropyl-3H-naphtho[1,2-d]imidazole-4,5-dione
- 3-Pentylbenzeneacetic acid sodium salt
- 4-(3-cyano-6-ethoxyquinolin-2-yl)-N- (2-fluorophenyl)-1,4-diazepane-1-carbothiomide
- 4-(6-(4-(piperazin-1-yl)phenyl_pyrazolo[1,5-a]pyrimidin-3-yl)quinoline hydrochloride
- 5'-As Cs As Ts Cs As Gs Ts Cs Ts Gs As Us As As Gs Cs Ts As-3'
- 5-{(1R,2R)-2-[(cyclopropylmethyl)amino]cyclopropyl}-N-(tetrahydro-2H-pyran-4-yl)thiophene-3-carboxamide monohydrochloride
- 6'-(R)-methyl-5-O-(5-amino-5,6-dideoxy-alpha-L-talofuranosyl)-paromamine sulfate
- A Humanized Bispecific Antibody Neutralizing Both Sclerostin and Dickkopf-1
- Acamprosate calcium
- Acebutolol
- Adeno-associated viral (AAV) vector expressing human retinoschisin-1 gene
- Adeno-associated viral vector containing the human ARSB gene
- Adeno-associated viral vector containing the human alpha-N-acetylglucosaminidase gene
- Adeno-associated viral vector serotype 2/6 encoding zinc-finger nucleases and the human alpha L-iduronidase gene
- Adeno-associated viral vector serotype 2/6 encoding zinc-finger nucleases and the human iduronate 2-sulfatase gene
- Adeno-associated viral vector serotype 9 containing the human N-acetylglucosaminidase alpha gene
- Adeno-associated viral vector serotype 9 containing the human iduronate-2-sulfatase gene
- Adeno-associated viral vector serotype 9 containing the human sulfamidase gene
- Adeno-associated viral vector serotype rh.10 carrying the human N-sulfoglucosamine sulfohydrolase cDNA
- Adeno-associated virus serotype HSC 15 expressing human iduronate 2-sulfatase
- Adenovirus-associated viral vector serotype 10 carrying the human N-sulfoglucosamine sulfohydrolase and sulfatase modifying factor 1 cDNAs
- Afatinib
- Allogeneic Fetal Mesenchymal Stem Cells
- Allogeneic cultured postnatal thymus-derived tissue
- Allogeneic retinal pigment epithelial cells genetically modified with a non-viral vector to express human alpha-L-iduronidase
- Alpelisib
- Alpha-L-iduronidase fused to Fab fragment of a humanised monoclonal antibody targeting human transferrin receptor
- Alpha-tocopherol and ascorbic acid
- Anti-fibroblast growth factor receptor 3 antigen-binding fragment (anti-FGFR3 Fab)
- Anti-human transforming growth factor beta (TGF-Beta) monoclonal antibody (mAb), based on the amino acid sequence of the human monoclonal antibody fresolimumab (GC1008) with the exception of one serine to proline substitution
- Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
- Ascorbic acid
- Asfotase alfa
- Ataluren
- Autologous CD34+ cells transduced with a lentiviral vector containing the human SGSH gene
- Autologous CD34+ haematopoietic stem and progenitor cells genetically modified with a lentiviral vector encoding for the N-acetylgalactosamine 6-sulfatase cDNA
- Autologous CD34+ haematopoietic stem and progenitor cells genetically modified with the lentiviral vector encoding for the human iduronate 2-sulfatase gene
- Autologous haematopoietic stem and progenitor cell population containing CD34+ cells transduced with a lentiviral vector encoding the TCIRG1 cDNA ex vivo expanded
- Autologous mesenchymal stromal cells on a decellularised tracheal scaffold from a cadaveric donor
- Autologous urothelial and smooth muscle cells
- Bacterial lipase
- Balipodect
- Bardoxolone methyl
- Beloranib
- Blarcamesine
- Burosumab
- C-type natriuretic peptide conjugated to multi-arm polyethylene glycol carrier through a cleavable linker
- Cannabidiol
- Cannabidivarin
- Carbamazepine (intravenous)
- Carbetocin
- Chemically modified human recombinant sulfamidase
- Chimeric fusion protein of recombinant human alpha-N-acetylglucosaminidase and human insulin-like growth factor 2
- Codergocrine mesilate, oxitriptan
- Crinecerfont
- DNA, (Cm-Gm-Gm-Gm-G-T-G-T-G-G-G-T-T-C-G-T-C-G-T-T-A-G-C-T-T-G-A-T-T-T-G-G-C-A-G-C-Um-Gm-Cm-Cm-(5'->3')-dT), 5'-ester with (29S)-29-(tert-butoxycarbonyl)-1-((hydroxyphosphoryl)oxy)-8,17,26,31-tetraoxo-10,13,19,22-tetraoxa-7,16,25,30-tetraazaoctatetracontan-48-oic acid
- Davunetide
- Diazoxide choline
- Elosulfase alfa
- Fixed-dose combination of (R-S) baclofen, naltrexone hydrochloride and D-sorbitol
- Galsulfase
- Gefitinib
- Genistein sodium salt dihydrate
- Human monoclonal antibody against activin A
- Humanised IGg1 monoclonal antibody targeting human transferrin receptor conjugated to human iduronate-2-sulfatase
- Humanised monoclonal antibody derivative against fibroblast growth factor receptor 3
- IPN-60130
- Ibudilast
- Idursulfase
- Idursulfase beta
- Infigratinib
- Interferon gamma 1b
- Itraconazole
- Laronidase
- Lentiviral vector carrying the Fanconi anaemia-A (FANCA) gene
- Lentiviral vector containing the human MYO7A gene
- Liprotamase
- Lisuride Maleate
- Lonafarnib
- Losartan
- Maralixibat chloride
- Mavoglurant
- Melatonin
- Metadoxine
- Metreleptin
- Miransertib
- Mirdametinib
- Mixture of two adeno-associated viral vectors serotype 8 containing the 5'-half sequence of human MYO7A gene and the 3'-half sequence of human MYO7A gene
- N-[(1R)-1-phenylethyl]-6-{1H-pyrazolo[3,4-d]pyrimidin-4-yl}quinazolin-2-amine
- N-[6-(cis-2,6-Dimethylmorpholin-4-yl)pyridine-3-yl]-2-methyl-4'-(trifluoromethoxy)[1,1'- biphenyl]-3-carboxamide
- N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino)benzamide
- N-sulfoglucosamine sulfohydrolase fused to a humanised monoclonal antibody targeting the human transferrin receptor
- N-terminal hexaglutamine-tagged recombinant human N-acetylgalactosamine-6-sulfate sulfatase
- Odiparcil
- Oxytocin
- Palovarotene
- Patidegib
- Pentosan polysulfate sodium
- Pravastatin / zoledronic acid
- Psilocybine
- R-baclofen
- Recifercept
- Recombinant AAV9 expressing human alpha-N-acetylglucosaminidase
- Recombinant AAV9 expressing human sulfoglucosamine sulfohydrolase
- Recombinant adeno-associated viral vector containing the human retinoschisin gene
- Recombinant adeno-associated viral vector serotype 9 containing human iduronidase gene
- Recombinant adeno-associated viral vector serotype 9 containing the human N-alpha-acetylglucosaminidase gene
- Recombinant adeno-associated virus (AAV) serotype HSC15 (rAAVHSC15) encoding human iduronate-2-sulfatase (hIDS)
- Recombinant adeno-associated virus (rAAV) vector expressing human retinoschisis protein RS1
- Recombinant human alkaline phosphatase
- Recombinant human alpha-N-acetylglucosaminidase
- Recombinant human ectonucleotide pyrophosphatase/phosphodiesterase 1 fused to the Fc fragment of IgG1
- Recombinant human heparan-N-sulfatase
- Recombinant human insulin receptor monoclonal antibody-fused iduronate 2-sulfatase ( HIRMAb-IDS)
- Recombinant human insulin receptor monoclonal antibody-fused-alpha-L-iduronidase
- Recombinant human insulin-like growth factor-I/recombinant human insulin-like growth factor binding protein-3
- Recombinant humanised monoclonal IgG2 lambda antibody against human sclerostin
- Recombinant microbial lipase
- Rilonacept
- Salmonella enterica, subsp. enterica, serovar Typhimurium, strain YS1646, live
- Self-complementary adeno-associated viral vector serotype 9 containing the SGSH gene
- Selumetinib
- Setmelanotide
- Single stranded, chemically modified oligonucleotide that binds to and inhibits the function of micro RNA-21
- Sodium (4-{(E)-3-(4-fluorophenyl)-3-[4-(3-morpholin-4-yl-prop1ynyl)phenyl]allyloxy}-2-methylphenoxy)acetate
- Somatropin
- Sulindac
- Synthetic cyclic 8 amino acid analogue of human unacylated ghrelin
- Trehalose
- Trofinetide
- Vatiquinone
- Vosoritide
- [5,10,15,20-tetrakis(4-carboxyphenyl)-21H,23H-porphine]manganese(III) chloride
- adeno-associated viral vector serotype 9 containing the human HGSNAT gene
- adeno-associated virus serotype 9 vector containing human n-acetylgalactosamine-6-sulfate sulfatase gene
- autologous CD34+ haematopoietic stem and progenitor cells genetically modified with the lentiviral vector IDUA LV, encoding for the alpha-L-iduronidase cDNA
- cyclo-L-glycyl-L-2-allylproline
- human allogeneic bone marrow derived osteoblastic cells
- p38 mitogen-activated kinase inhibitor (p38 MAPK)
- tideglusib
- verucerfont
- vestronidase alfa
