Orphanet: Wyszukaj lek sierocy
Wyszukaj lek sierocy
85 Wyniki
1-(3-{4-[3,4-difluoro-2-(trifluoromethyl)phenyl]piperidine-1-carbonyl}-1H,4H,5H,6H,7H-pyrazolo[3,4-c]pyridin-6-yl)ethan-1-one 17-(Dimethylaminoethylamino)-17-demethoxygeldanamycin (after administration of adeno-associated viral vector encoding an inducible short hairpin RNA targeting claudin-5) 2'-O-(2-Methoxyethyl)-modified antisense oligonucleotide targeting exon 13 in the USH2A gene 3-(3-(3,5-bis(trifluoromethyl)phenyl)-1h-pyrazol-1-yl)propanoic acid 3-Pentylbenzeneacetic acid sodium salt 3-[(4aR,6R,7R,7aS)-7-hydroxy-2-oxido-2-sulfanylidene-4a,6,7,7a-tetrahydro-4H-furo [3,2-d][1,3,2] dioxaphosphinin-6-yl]-2-bromo-6-phenyl-5H-imidazo[1,2-a]purin-9-one 4,7,10,13,16,19-Docosahexaenoic acid 4-[(2E)-1-oxo-3-(2,6,6-trimethyl-1-cyclohexen-1-yl)-2-propen-1-yl]-1-piperazinecarboxamide 9-cis-Retinyl acetate Adalimumab Adeno-associated viral vector containing DNA encoding an RNAi targeting rhodopsin / adeno-associated viral vector containing a rhodopsin gene Adeno-associated viral vector encoding an inducible short hairpin RNA targeting claudin-5 (prior to administration of 17-dimethylaminoethylamino-17-demethocygeldanamycin) Adeno-associated viral vector serotype 2 containing the human CHM gene encoding human Rab escort protein 1 Adeno-associated viral vector serotype 2 containing the human REP1 gene Adeno-associated viral vector serotype 2 containing the human Rab escort protein 1 gene Adeno-associated viral vector serotype 2.7m8 containing the ChrimsonR-tdTomato gene Adeno-associated viral vector serotype 5 containing the human ABCA4 gene Adeno-associated viral vector serotype 5 containing the human CHM gene Adeno-associated viral vector serotype 5 containing the human RLBP1 gene Adeno-associated viral vector serotype 8 containing the human AIPL1 gene Adeno-associated viral vector serotype 8 containing the human CNGA3 gene under the control of a cone arrestin promoter Adeno-associated viral vector serotype 8 containing the human GUCY2D gene Adeno-associated viral vector serotype 8 encoding engineered rhodopsin DNA-binding repressor and human rhodopsin expression cassettes Adeno-associated virus serotype 8 containing the human RdCVF sequence and the human RdCVFL sequence Adenovirus associated viral vector serotype 2/8 containing the human CNGA3 gene Adenovirus associated viral vector serotype 4 containing the human RPE65 gene Adenovirus associated viral vector serotype 5 containing the human RPE65 gene Adenovirus associated viral vector serotype 5 containing the human pde6 beta gene Adenovirus associated viral vector serotype 8 containing the human CNGB3 gene Adenovirus-associated viral vector serotype 2 containing the human RPE65 gene (AAV2-hRPE65v2 ) Adenovirus-associated viral vector serotype 8 containing the human RPGR gene All-cis-docosa-4,7,10,13,16,19-hexaenoic acid Allogeneic fetal human retinal progenitor cells expanded ex vivo Allogeneic human umbilical cord tissue-derived cells Allogeneic retinal epithelial cells transfected with plasmid vector expressing ciliary neurotrophic growth Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Antisense oligonucleotide complementary to the exonic splicer enhancer sequence at intron 26 of the centrosomal protein 290 pre-mRNA Antisense oligonucleotide targeting exon 13 in the USH2A gene Antisense oligonucleotide targeting the USH2A gene Combination of three adeno-associated viral vectors of serotype 8 containing the 5'-, the body- and the 3'- coding sequences of human CEP290 fused to inteins Combination of two adeno-associated viral vectors of serotype 8 containing the 5'- and the 3'- half coding sequences of human ABCA4 fused to inteins E. Coli heat-shock protein 70 with bovine retinal S-antigen Echothiophate iodide Ecothiopate iodide Emixustat hydrochloride Encapsulated human retinal pigment epithelial cell line transfected with plasmid vector expressing human ciliary neurotropic factor Expanded human allogeneic neural retinal progenitor cells extracted from neural retina HLA-B27 derived peptide (amino acid 125-138) Human Umbilical Tissue-Derived Cells Human embryonic stem-cell-derived retinal pigment epithelial cells Lentiviral vector containing the human ABCA4 gene Lentiviral vector containing the human MYO7A gene Ma09-Hrpe Cells Mecasermin rinfabate Methotrexate Mixture of two adeno-associated viral vectors of serotye 8 containing the 5'-half sequence of human ABCA4 gene and the 3'-half sequence of human ABCA4 gene Mixture of two adeno-associated viral vectors serotype 8 containing the 5'-half sequence of human MYO7A gene and the 3'-half sequence of human MYO7A gene Myriocin Non-replicating recombinant adeno-associated virus vector containing a fragment of the gene encoding channelrhodopsin-2 protein Propranolol hydrochloride Ramiprilat Recombinant adeno-associated viral vector containing the human CNGB3 gene Recombinant adeno-associated viral vector containing the human RPGR gene Recombinant adeno-associated viral vector expressing the human CNGA3 gene Recombinant adeno-associated viral vector serotype 5 encoding Staphylococcus aureus Cas9 endonuclease and two guide RNAs complementary to two regions of intron 26 of the CEP290 gene Recombinant human mesencephalic astrocyte-derived neurotrophic factor (MANF) Recombinant human methionine proinsulin Recombinant human nerve growth factor Recombinant human proinsulin Recombinant human rod-derived cone viability factor Recombinant lens epithelium derived growth factor 1-326 (LEDGF1-326) Retinol Setmelanotide Soraprazan Unoprostone isopropyl adenovirus associated viral vector serotype 5 containing the RPGR gene
