Orphanet: Wyszukaj lek sierocy
Wyszukaj lek sierocy
161 Wyniki
- (1S,4R,5R,7S)-3,4-dibenzyl-2-oxo-6,8-dioxa-3-azabyciclo[3.2.1]octane-7-carboxylic acid-L-lysine
- (2'R,3'S)-2'-hydroxy-N-carboxy-3'-amino-5'-methyl-hexanoic,N-tert-butyl ester, 13 ester 5B-20-epoxy-1B,2a,4a,7B,9a,10a,13a-heptahydroxy-4,10-diacetate-2-benzoate-(1"S)-7,9-acrolein acetal-11(15-1)-abeotaxane
- (S)-N-(5-(4-(1-(benzo[d][1,3]dioxol-5-yl)ethyl)piperazin-1-yl)-1,3,4-thiadiazol-2-yl)acetamide, hydrochloride salt
- 1-(3-{4-[3,4-difluoro-2-(trifluoromethyl)phenyl]piperidine-1-carbonyl}-1H,4H,5H,6H,7H-pyrazolo[3,4-c]pyridin-6-yl)ethan-1-one
- 17-(Dimethylaminoethylamino)-17-demethoxygeldanamycin (after administration of adeno-associated viral vector encoding an inducible short hairpin RNA targeting claudin-5)
- 2'-O-(2-Methoxyethyl)-modified antisense oligonucleotide targeting exon 13 in the USH2A gene
- 2-(2-(18F)fluoropyridin-4-yl)-9H-pyrrolo[2,3-b:4,5-c']dipyridine
- 3-(3-(3,5-bis(trifluoromethyl)phenyl)-1h-pyrazol-1-yl)propanoic acid
- 3-Pentylbenzeneacetic acid sodium salt
- 3-[(4aR,6R,7R,7aS)-7-hydroxy-2-oxido-2-sulfanylidene-4a,6,7,7a-tetrahydro-4H-furo [3,2-d][1,3,2] dioxaphosphinin-6-yl]-2-bromo-6-phenyl-5H-imidazo[1,2-a]purin-9-one
- 3-{[2,3,5,6-tetrafluoro-3'-(trifluoromethoxy)biphenyl-4-yl]carbamoyl}thiophene-2-carboxylic acid
- 4,7,10,13,16,19-Docosahexaenoic acid
- 4-((E)-(5-(2-(2-((S)-2-((S)-1-(L-threonyl-L-lysyl)pyrrolidine-2-carboxamido)-5-guanidinopentanamido)acetamido)-2-carboxyethyl)-2-hydroxyphenyl)diazenyl)phenyl (2-(trimethylammonio)ethyl) phosphate
- 4-(4-Methoxy-phenylamino)-6-methylcarbamyl-quinoline-3-carboxylic acid
- 4-[(2E)-1-oxo-3-(2,6,6-trimethyl-1-cyclohexen-1-yl)-2-propen-1-yl]-1-piperazinecarboxamide
- 9-cis-Retinyl acetate
- Adalimumab
- Adeno-associated viral (AAV) vector expressing human retinoschisin-1 gene
- Adeno-associated viral vector containing DNA encoding an RNAi targeting rhodopsin / adeno-associated viral vector containing a rhodopsin gene
- Adeno-associated viral vector containing the human NADH dehydrogenase 4 gene (rAAV2/2-ND4)
- Adeno-associated viral vector encoding an inducible short hairpin RNA targeting claudin-5 (prior to administration of 17-dimethylaminoethylamino-17-demethocygeldanamycin)
- Adeno-associated viral vector serotype 2 containing the human CHM gene encoding human Rab escort protein 1
- Adeno-associated viral vector serotype 2 containing the human REP1 gene
- Adeno-associated viral vector serotype 2 containing the human Rab escort protein 1 gene
- Adeno-associated viral vector serotype 2.7m8 containing the ChrimsonR-tdTomato gene
- Adeno-associated viral vector serotype 5 containing the human ABCA4 gene
- Adeno-associated viral vector serotype 5 containing the human CHM gene
- Adeno-associated viral vector serotype 5 containing the human RLBP1 gene
- Adeno-associated viral vector serotype 8 containing the human AIPL1 gene
- Adeno-associated viral vector serotype 8 containing the human CNGA3 gene under the control of a cone arrestin promoter
- Adeno-associated viral vector serotype 8 containing the human GUCY2D gene
- Adeno-associated viral vector serotype 8 encoding engineered rhodopsin DNA-binding repressor and human rhodopsin expression cassettes
- Adeno-associated virus serotype 2/8 vector containing the human PDE6A gene
- Adeno-associated virus serotype 5 containing the human RDH12 gene
- Adeno-associated virus serotype 8 containing the human RdCVF sequence and the human RdCVFL sequence
- Adenovirus associated viral vector serotype 2/8 containing the human CNGA3 gene
- Adenovirus associated viral vector serotype 4 containing the human RPE65 gene
- Adenovirus associated viral vector serotype 5 containing the human RPE65 gene
- Adenovirus associated viral vector serotype 5 containing the human pde6 beta gene
- Adenovirus associated viral vector serotype 8 containing the human CNGB3 gene
- Adenovirus-associated viral vector serotype 2 containing the human RPE65 gene (AAV2-hRPE65v2 )
- Adenovirus-associated viral vector serotype 8 containing the human RPGR gene
- Alglucerase
- All-cis-docosa-4,7,10,13,16,19-hexaenoic acid
- Allogeneic ABCB5-positive limbal stem cells
- Allogeneic fetal human retinal progenitor cells expanded ex vivo
- Allogeneic human umbilical cord tissue-derived cells
- Allogeneic retinal epithelial cells transfected with plasmid vector expressing ciliary neurotrophic growth
- Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
- Antisense oligonucleotide complementary to the exonic splicer enhancer sequence at intron 26 of the centrosomal protein 290 pre-mRNA
- Antisense oligonucleotide targeting exon 13 in the USH2A gene
- Antisense oligonucleotide targeting the USH2A gene
- Ataluren
- Autologous collagen type II-specific regulatory T cells
- Autologous cultured endothelial cells on a donor human corneal disk
- Ciclosporin
- Ciclosporin (eye drops, solution)
- Combination of three adeno-associated viral vectors of serotype 8 containing the 5'-, the body- and the 3'- coding sequences of human CEP290 fused to inteins
- Combination of two adeno-associated viral vectors of serotype 8 containing the 5'- and the 3'- half coding sequences of human ABCA4 fused to inteins
- Cultured allogeneic corneal limbal stem cells
- Cyclo {{(E,Z)-(2S,3R,4R)-3-hydroxy-4-methyl-2-(methylamino)nona-6,8-dienoyl}-L-2-aminobutyryl-N-methyl-glycyl-N-methyl-L-leucyl-L-valyl-N-methyl-L-leucyl-L-alanyl-Dalanyl-N-methyl-L-leucyl-N-methyl-L-leucyl-N-methyl-L-valyl}
- DNA plasmid encoding a recombinant fusion protein consisting of the extracellular domain of human TNFalpha p55 receptor linked to the human IgG1 Fc domain
- DNA plasmid encoding human transferrin gene
- Davunetide
- Dexamethasone (intravitreal implant)
- Difluprednate
- E. Coli heat-shock protein 70 with bovine retinal S-antigen
- Echothiophate iodide
- Ecothiopate iodide
- Eculizumab
- Emixustat hydrochloride
- Encapsulated human retinal pigment epithelial cell line transfected with plasmid vector expressing human ciliary neurotropic factor
- Ex vivo expanded autologous human corneal epithelium containing stem cells
- Expanded human allogeneic neural retinal progenitor cells extracted from neural retina
- Fluocinolone
- Fluocinolone acetonide (prolonged-release intravitreal implant)
- Gevokizumab
- HLA-B27 derived peptide (amino acid 125-138)
- Human Umbilical Tissue-Derived Cells
- Human embryonic stem-cell-derived retinal pigment epithelial cells
- Human engineered monoclonal antibody specific for Transforming Growth Factor ß2
- Human plasminogen
- Humanised IgG4 monoclonal antibody against extracellular tau
- Humanized anti-IL-6R receptor neutralizing IgG2 monoclonal antibody
- Imiglucerase
- Inebilizumab
- Lentiviral vector containing the human ABCA4 gene
- Lentiviral vector containing the human MYO7A gene
- Ma09-Hrpe Cells
- Mecasermin rinfabate
- Methotrexate
- Methylthioninium
- Miltefosine
- Mixture of two adeno-associated viral vectors of serotye 8 containing the 5'-half sequence of human ABCA4 gene and the 3'-half sequence of human ABCA4 gene
- Mixture of two adeno-associated viral vectors serotype 8 containing the 5'-half sequence of human MYO7A gene and the 3'-half sequence of human MYO7A gene
- Myriocin
- N-(3-(4-(3-(diisobutylamino)propyl)piperazin -1-yl)propyl)-1H-benzo[d]imidazol-2-amine disulphate
- N-({Carbamoylmethyl-[3-(2-oxo-pyrrolidin-1-yl)-propyl]-carbamoyl}-methyl)-2-[2-(2-fluoro-phenyl)-ethylamino]-N-isobutyl-acetamide
- Non-replicating recombinant adeno-associated virus vector containing a fragment of the gene encoding channelrhodopsin-2 protein
- Polyhexamethylene biguanide (PHMB)
- Propranolol hydrochloride
- Ramiprilat
- Recombinant adeno-associated viral vector containing the human CNGB3 gene
- Recombinant adeno-associated viral vector containing the human RPGR gene
- Recombinant adeno-associated viral vector containing the human retinoschisin gene
- Recombinant adeno-associated viral vector expressing the human CNGA3 gene
- Recombinant adeno-associated viral vector serotype 5 encoding Staphylococcus aureus Cas9 endonuclease and two guide RNAs complementary to two regions of intron 26 of the CEP290 gene
- Recombinant human mesencephalic astrocyte-derived neurotrophic factor (MANF)
- Recombinant human methionine proinsulin
- Recombinant human monoclonal antibody to human Interleukin (IL)-17A of the IgG1/k class
- Recombinant human nerve growth factor
- Recombinant human proinsulin
- Recombinant human rod-derived cone viability factor
- Recombinant human serum amyloid P
- Recombinant lens epithelium derived growth factor 1-326 (LEDGF1-326)
- Retinol
- Setmelanotide
- Sirolimus
- Soraprazan
- Tacrolimus hydrate
- Tilavonemab
- Tolfenamic acid
- Tranilast
- Triamcinolone
- Unoprostone isopropyl
- Voclosporin
- adeno-associated viral vector serotype 9 containing the human glucocerebrosidase gene
- adenovirus associated viral vector serotype 5 containing the RPGR gene
- idebenone
- satralizumab
- tideglusib
