
Pesquisar um medicamento órfão

* (*) campo(s) de preenchimento obrigatório

Outras opções de pesquisa

PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'

  • INN (International Nonproprietary Name) : -
  • Nome do código : -
  • Nome químico ou descrição : -
  • Tipo de produto : Ingrediente/substância
  • Tipo de produção : Sintético / química extractiva
  • Designação órfã : EUA

Informação adicional

Investigação sobre este medicamento

Os documentos contidos neste website são apresentação para efeitos apenas de informação. O material não substitui os cuidados médicos profissinais por um especialista profissional qualificado e não deve ser usado como base para diagnóstico ou tratamento.